Frequently Asked Questions

Allgemeines

Wo finden Sie uns?

Das BMFZ befindet sich auf dem Campus der Heinrich-Heine Universität Düsseldorf. Die genaue Beschreibung der Anreise entnehmen Sie bitte dem folgenden Link: Anreise und Lageplan

Das GTL finden Sie im Gebäude 23.12 in folgenden Räumlichkeiten:

  • Laborleitung: 4. Etage, Raum 89
  • DNA-Sequenzierungen, DNA-Analytik: 4. Etage, Raum 84 und 86
  • Microarray-Labor, Real-Time PCR, RNA-Analytik: 2. Etage, Raum 25

Probentransport

In der folgenden Tabelle finden Sie unsere Empfehlungen für Probentransport.

Persönliche Probenübergabe Versand*
Sequenzierung Sanger RT RT
Fragmente RT RT / getrocknet
Quality Control DNA RT RT
RNA auf Eis auf Trockeneis
Sequenzierung NGS RNA auf Eis auf Trockeneis
Library auf Eis auf Trockeneis
gDNA RT RT

* Das Qualitätsmanagementsystem sieht eine persönliche Probenübergabe vor.

Welchen Stellenwert hat der Datenschutz?

Wir messen dem Datenschutz eine sehr hohe Bedeutung bei und tragen dieser Tatsache durch eine eigene Datenschutzerklärung sowie mit der vom Datenschutzbeauftragten der HHU genehmigten Verfahrensbeschreibung Rechnung.

Besitzt das GTL ein Qualitätsmanagementsystem?

Ja, das GTL arbeitet mit einem QM-System und ist in den Bereichen Sanger-Sequenzierung und DNA-Fragmentanalyse seit dem Juni 2010 nach der DIN EN/ISO 9001:2008 zertifiziert (Zertifikat-Registrier-Nr. 01 100 101390) Deutsch und Englisch.

Sanger-Sequenzierungsanalysen, DNA-Fragmentanalysen und AmpliSeq-basierte NGS-Sequenzierungsanalysen sowie quantitative und qualitative Nukleinsäuremessungen sind zusätzlich nach der DIN EN ISO/IEC 17025:2005 akkreditiert (D-PL-13362-02-00)



Welche Analysetypen (Kategorien) gibt es im Bereich der Sanger Sequenzierung?

Sie haben die Wahl zwischen:

1.) „Full-Service“

Wir führen alle Analyseschritte für Sie durch. Bei Bedarf wiederholen und optimieren wir die Analyseparameter. Die resultierenden DNA-Sequenzierungsergebnisse werden auf ihre Qualität hin untersucht und manuell überarbeitet („editiert"). Alle wichtigen Informationen zu den Proben werden über das Web-basiertes Eingabesystem eingegeben oder in Form einer Excelliste übermittelt. Die dazu entsprechende Vorlage finden Sie im Downloadbereich.

Sie wählen zwischen:
  • kurze (short: ca. 500 bp) Sequenzanalysen von PCR-Produkten („Standard-S“)
  • lange (long: ca. 1000 bp) Sequenzanalysen von Plasmiden („Standard-L“)
  • sehr schnellen (ca. 4 Std.) Sequenzanalysen („Xpress-S“)

2.) „Expert-Service“

Wenn Sie Erfahrung im Umgang mit Sequenzierungsproben haben und wissen, dass Ihre DNA-Templates sich gut sequenzieren lassen, führen wir für Sie Kosten-günstige Sanger Sequenzierungen durch. Wir bearbeiten dazu Ihre Proben nach etablierten und optimierten Standard Protokollen. Bei Sequenzierungsausfällen aufgrund schwieriger DNA-Template Sequenzen wiederholen wir die Analysen jedoch nicht kostenfrei (keine Optimierungen). Die Sequenzierungsergebnisse werden nicht manuell editiert sondern automatisiert prozessiert und Ihnen übermittelt. Alle wichtigen Informationen zu den Proben werden über das Web-basiertes Eingabesystem eingegeben oder in Form einer Excelliste übermittelt. Die dazu entsprechende Vorlage finden Sie im Downloadbereich.

Sie wählen zwischen:
  • kurze (ca. 500bp) Sequenzanalysen („Xpert-S“)
  • lange (ca. 800bp) Sequenzanalysen („Xpert-L“)

Für Proben dieses Analysetyps wird grundsätzlich kein schriftlicher Prüfbericht erstellt.

3.) Analyse von vorgemischten Proben („Pre-mixed“)

Sie bereiten entspreche DNA-Templatemengen sowie Primer und Wasser in passenden 96Well Microtiterplatten vor. Wir komplettieren die Sequenzreaktion und führen die Aufreinigung sowie die Analyse auf einem Sequenziergerät durch. Die resultierenden DNA-Sequenzierungsergebnisse werden auf ihre Qualität hin untersucht und überarbeitet („editiert"). Wiederholungen können bei dieser Auftragsart in der Regel nicht kostenfrei durchgeführt werden. Sämtliche Informationen zu Ihren Proben werden in Form einer Excelliste an uns übermittelt. Die dazu entsprechende Vorlage finden Sie im Downloadbereich.

Sie wählen zwischen:
  • kurze (ca. 500bp) Sequenzanalysen („Premixed-S“)
  • lange (ca. 800bp) Sequenzanalysen („Premixed-L“)

4.) Analyse von komplett vorbereiteten Proben („Ready-to-load“)

Sie führen die komplette Sequenzierreaktion eigenständig durch und geben Ihre aufgereinigten, bereits in Formamid gelösten Sequenzierproben bei uns ab. Wir führen die Analyse auf dem Sequenziergerät durch. Die resultierenden DNA-Sequenzierungsergebnisse werden auf ihre Qualität hin untersucht und manuell überarbeitet („editiert"). Wiederholungen können bei dieser Auftragsart in der Regel nicht kostenfrei durchgeführt werden. Alle wichtigen Informationen zu den Proben werden über das Web-basiertes Eingabesystem eingegeben oder in Form einer Excelliste übermittelt. Die dazu entsprechende Vorlage finden Sie im Downloadbereich.

Sie wählen zwischen:
  • kurze (ca. 500bp) Sequenzanalysen („Readytoload-S“)
  • lange (ca. 800bp) Sequenzanalysen („Readytoload-L“)

5.) Fragmentanalyse

Zur Bestimmung von DNA-Fragmentgrößen geben Sie Ihre farbmarkierten und in Formamid gelösten Proben bei uns ab. Auf Wunsch versetzen wir Ihre Proben mit entsprechenden Längenstandards und unterstützen Sie bei der Auswertung. Sämtliche Informationen zu Ihren Proben werden in Form einer Excelliste an uns übermittelt. Die dazu entsprechende Vorlage finden Sie im Downloadbereich.

Sie wählen zwischen:
  • Fragmentanalysen von komplett vorbereiteten und mit Längenstandard versetzten Proben („Readytorun-F1“)
  • Fragmentanalysen bei denen wir einen entsprechenden Längenstandard zusetzen („Prepared-F2“)
  • Fragmentanalysen bei denen wir einen entsprechenden Längenstandard zusetzen und für Sie die Auswertung übernehmen („Prepared-F3“)

Antragsformulare? Auftragsvorlagen? Infoblätter?

Unter dem Menüpunkt ‚Services’ finden Sie unseren ‚Download’ Bereich mit hilfreichen Vorlagen und Infotexten zu unseren Dienstleistungen.

Welche FarbstoffSets werden angeboten?

Unter dem Menüpunkt ‚Services’ finden Sie unseren ‚Download’ Bereich mit hilfreichen Vorlagen und Infotexten zu unseren Dienstleistungen.

FarbstoffSets

DNA-Analytik

Welche Sequenzieraufträge kann ich erteilen?

Die von uns angebotenen Sequenzieraufträge können Sie unserem Leistungsspektrum entnehmen.

Wie erfolgt die Auftragsabwicklung?

Um unseren DNA-Analytik-Service nutzen zu können, müssen Sie sich registrieren.

Wir benötigen folgende Unterlagen:

a) Bei der Abgabe Ihres ersten Auftrags bringen sie bitte die unterschriebene Einwilligung zur Datenschutzerklärung mit.

b) Schriftliche Auftragserteilung, z.B. in Form eines „Blockzettels" oder eines Instituts-internen Auftragsscheins. Tragen Sie bitte die Anzahl der angeforderten Sequenzierungen, die gewünschte Leseweite (ca. 850 bp oder 500 bp) bzw. die Anzahl der Fragmentanalysen, die Kostenstellennummer sowie die Auftragsnummer ein und lassen ihn vom zuständigen Projektleiter unterschreiben.
Wir können nur Aufträge bearbeiten, die uns mit einem unterschriebenen Blockzettel erreichen.

c) DNA-Proben: Bitte beschriften Sie Ihre Proben-, bzw. Primergefäße gut leserlich. Achten Sie bitte auch auf übereinstimmende Bezeichnungen der jeweiligen Probe im Auftragsformular und auf dem Probengefäß.
Nach der Übermittlung Ihrer Daten mittels der Web-basierten Eingabemaske, bekommen Sie eine Auftragsnummer mitgeteilt.

Zu Dokumentationszwecken können Sie sich diese Seite ausdrucken. Die Auftragsnummer vermerken Sie bitte auf der Probentüte, bzw. Probenbox.

Falls Sie uns die Informationen zu Ihren Proben per Excelliste übermitteln, wird Ihre Anforderung als „Sonderauftrag" gehandhabt. Bitte denken Sie daran, uns die entsprechende Excelliste per zukommen zu lassen.

Sie werden automatisch per eMail über den Abschluss des Auftrages informiert und aufgefordert, Ihre Ergebnisse von unserem Server über den Menuepunkt in der Navigationsleiste auf Ihren eigenen Rechner zu transferieren (nur der "Download" der komprimierten "Zip"-Datei ist möglich). In der Regel berichten wir in vereinfachter Form die reinen Ergebnisdaten.

Bitte beachten Sie auch die Kunden-Information, die Sie mit Ihren Sequenzdaten erhalten. Diese Informationen können wichtig für die Interpretation Ihrer Daten sein und enthalten gegebenenfalls auch Hinweise zum Gelingen weiterer Sequenzierungen.


Wir belassen Ihre Sequenzen mindestens ein Jahr auf unserem Server, so dass Sie auch die Ergebnisse älterer Aufträge langfristig abrufen können. Ihre (DNA) Proben bewahren wir allerdings nur ca. 1 Woche auf!

Wichtig: Ihre DNA-Proben dürfen maximal der Sicherheitsstufe S1 unterliegen.

Welche Anforderungen werden an die DNA-Proben gestellt?

Die exakte Konzentrationsangabe und die Qualität Ihres Templates (Plasmide oder PCR-Produkte) bestimmen maßgeblich den Erfolg der Sequenzierreaktion. Das Verhältnis der optischen Dichte (OD) bei 260 und 280 nm OD260/OD280 sollte zwischen 1.8 und 2.0 liegen.

Die DNA sollte in reinstem Wasser oder 10 mM Tris/HCl pH 8 gelöst sein. Auf keinen Fall darf die DNA zur Sequenzierung in TE [Tris/EDTA] aufgenommen sein.

Da wir die Analysen in gentechnischen Laboratorien der Sicherheitsstufe S1 durchführen, dürfen Ihre Proben auf keinen Fall einer höheren Sicherheitsstufe unterliegen!

a) Plasmide

Bei der Aufreinigung von Plasmid-DNA zur Sequenzierung ist auf eine effiziente Abtrennung von Proteinen, genomischer DNA, RNA, Salzen und Lösungsmitteln zu achten, z.B. mit kommerziellen Kits, um ein qualitativ hochwertiges Sequenzierergebnis (hohe Leseweite, gute Datenqualität) zu erhalten.

b) PCR-Produkte

PCR-Fragmente können ohne vorherige Subklonierung sequenziert werden, allerdings ist eine Aufreinigung der PCR-Fragmente zur Abtrennung der PCR-Komponenten (Primer, Nukleotide, Puffer) im Vorfeld der Sequenzierung unerlässlich. Diese kann mit handelsüblichen Kits, säulenbasierten Aufreinigungskits für PCR-Fragmente, Kits zur Elution von Fragmenten aus Agarosegelen oder durch spezifischen enzymatischen Verdau der Primer erfolgen.

Template-Mengen

Art Konzentration Menge
50 bp - 0,5 kb 5 - 15 ng / µl 50 ng
0,5 kb - 1 kb 15 - 50 ng / µl 300 ng
1 kb - 4 kb 50 - 150 ng / µl 700 ng
4 kb - 15 kb 150 - 600 ng / µl > 2 µg
> 15 kb > 600 ng / µl > 2 µg
Primer 10 pmol / µl 5 µl

Bitte überlassen Sie uns ausreichende DNA-Mengen, damit wir die Möglichkeit haben gegebenenfalls Optimierungs- bzw. Kontrollreaktionen durchführen zu können.

Wie lange dauert die Bearbeitung meines DNA-Auftrags?

Wenn uns Ihre Proben vor 9 Uhr erreichen, erhalten Sie bei problemlosen Sequenzierungen die Ergebnisse in der Regel am folgenden Arbeitstag. Falls Sie besonders wichtige und dringende Proben haben, können diese Proben auch innerhalb von 4 Stunden bearbeitet werden (XPress-Service).

Welche Leseweiten werden angeboten?

Sie können wählen zwischen „long read" Analysen mit bis zu 1000 bp und "short read" Analysen mit ca. 500 bp Sequenzinformation. Bitte vermerken Sie auf dem Auftragsformular/Abrechnungszettel deutlich die gewünschte Auftragskategorie (Leistungsspektrum).

Wichtig: „long read" und „short read" Analysen können in einem Auftrag nicht gemischt werden.

Kann ich eigene Primer verwenden?

Natürlich können für die Sequenzierung auch Ihre eigenen Primer verwendet werden. Bitte beachten Sie:
Falls wir Ihre individuellen Primer benutzen sollen, müssen diese auf 10 pmol/µl eingestellt sein (entspricht 10 µM). Bitte teilen Sie uns auch den Tm-Wert Ihres Primers bei abweichender Annealingtemperatur mit (Standardeinstellung >= 50°C). Bei der Auswahl/Konstruktion Ihrer individuellen Primer beachten Sie bitte, dass zwischen dem 3'-Ende des Primers (Beginn der Sequenzierung) und den ersten verlässlich lesbaren Basen 30-50 Basen liegen sollten. Andernfalls gehen Ihnen möglicherweise Sequenzinformationen am 5'-Ende Ihrer Sequenz verloren.

Welche Primer stehen zur Verfügung?

Wir haben eine Vielzahl von Standardprimern vorrätig, die wir gerne kostenfrei für Ihre DNA-Sequenzanalyse einsetzen.

Aktuell vorhandene Primer:

Primer Sequenz 5' - 3' z.B. geeignet für:
M13-universal TGTAAAACGACGGCCAGT pUC und pBluescript Vektoren
M13-Fwd GTAAAACGACGGCCAGTG
M13-Rev GGAAACAGCTATGACCATG
T3 ATTAACCCTCACTAAAGGGA
T7 GTAATACGACTCACTATAGGG
T3-II AATTAACCCTCACTAAAGGG
T7-II TAATACGACTCACTATAGG
SP6 ATTTAGGTGACACTATAG
BGH-Rev TAGAAGGCACAGTCGAGG
Weitere Primer auf Anfrage

Wie lange werden meine Proben gelagert?

Ihre (DNA)Proben bewahren wir ca. 1 Woche auf! Versehen Sie Ihren Auftrag / Probentüte mit einem entsprechenden Vermerk, wenn Sie Ihr Probenmaterial zeitnah abholen möchten. Wir belassen Ihre Sequenzen mindestens ein Jahr auf unserem Server, so dass Sie auch die Ergebnisse älterer Aufträge langfristig abrufen können.

Was kosten DNA- und RNA-Analysen?

Die stets aktuellen Preise für unsere Dienstleistungen finden sie unter dem Link Preise und dessen Unterseiten.

Werden auch Proben externer Auftraggeber bearbeitet?

Natürlich bearbeiten wir auch sehr gerne Proben von externen Auftraggebern. Wenn Sie diesbezüglich Fragen haben, können Sie uns gerne .

Wie kann ich mir meine Daten ansehen?

Als Ergebnis der DNA-Sequenzierung erhalten Sie je sequenzierter Probe 2 Dateien mit den Endungen <.ab1> und <.seq>. Ergebnisdateien der DNA-Fragmentanalyse tragen die Endung <.fsa>. Es handelt sich um PC-Files. Mit folgenden Freeware-Programmen können Sie die Dateien öffnen:

Wie sehen gute Sequenzierergebnisse aus? Wie soll ich das Sequenzierergebnis bewerten?

Was Beispiel Kommentar/Konsequenz
gutes Ergebnis
---

Bild der ISO-Zertifizierung
---
Bild der ISO-Zertifizierung
Das ist unser Ziel.
Kein Signal
---
Bild der ISO-Zertifizierung
Kein Signal, Dyes
---
Bild der ISO-Zertifizierung

---
Bild der ISO-Zertifizierung
kein auswertbares Ergebnis; keine Signale der Sequenzierchemie erkennbar

RNA-Analytik

Welche Anforderungen werden an die RNA-Proben gestellt?

RNA-Proben für die Bioanalyzer-Analyse sollten in mindestens 3 µl Wasser oder Elutionspuffer bereitgestellt werden. Achten Sie dabei bitte darauf, dass die Konzentration passend zu dem von Ihnen beauftragten Chip-Typ eingestellt worden ist (RNA NanoChip: 50 – 500 ng/µl; RNA PicoChip: 500 – 5000 pg/µl), da wir das Handling der Proben vor Ort minimieren und die einzelnen Proben weder nachmessen noch weiteren Verdünnungen durchführen. Für Fehlmessungen aufgrund falscher Probenkonzentration kommen wir daher nicht auf.

Wie lange dauert die Bearbeitung meines RNA-Auftrags?

Qualitative (BioAnalyzer) und quantitative (Qubit) RNA-Analysen Ihrer Proben führen wir in der Regel innerhalb von zwei Arbeitstagen durch.

In welcher Form werden die RNA-Analyse-Daten bereitgestellt?

Die Bioanalyzer-Ergebnisse werden in vereinfachter Form berichtet und sowohl als pdf-Datei als auch als Original-Datei im xad-Format direkt nach Abschluss der Analysen in Ihrem Kundenaccount ohne besondere Nachricht abgelegt (die Daten der xad-Datei können mit der 2100 Bioanalyzer Expert Software von Agilent eingelesen und reanalysiert werden).

Wie lange werden bereits analysierte RNA-Proben im GTL aufbewahrt?

Bereits analysierte RNA-Proben werden nach Bereitstellung der Ergebnisse maximal fünf Werktage bei -20°C gelagert und anschließend entsorgt. Sollten Sie die Rückgabe der RNA wünschen, vermerken Sie dies bitte auf dem entsprechenden Blockzettel bzw. holen Sie Ihre Proben direkt nach Abschluss der Analysen wieder bei uns ab.

GENERELL GILT: Geben Sie uns bitte NUR ALIQUOTS Ihrer RNA-Präparationen zur Analyse!

Kann auch prokaryotische RNA untersucht werden?

Wir können natürlich auch prokaryotische RNA-Präparationen mit dem Bioanalyzer untersuchen. Geben Sie uns dazu bitte bei der Probenabgabe einen entsprechenden Hinweis, damit der Bioanalyser dahingehend konfiguriert werden kann (zur korrekten Identifikation der 16S- bzw. 23S rRNA und Vergabe einer entsprechenden RIN).

Können auch pflanzliche RNA-Präparationen untersucht werden?

Wir können natürlich auch pflanzliche RNA-Präparationen mit dem Bioanalyzer untersuchen. Geben Sie uns dazu bitte bei der Probenabgabe einen entsprechenden Hinweis, damit der Bioanalyser dahingehend konfiguriert werden kann (zur korrekten Identifikation der zusätzlichen plastidären rRNA und Vergabe einer entsprechenden RIN).